Review



tccctccactcggaaggac sangon biotech n a primer c myc reverse  (Sangon Biotech)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Sangon Biotech tccctccactcggaaggac sangon biotech n a primer c myc reverse
    Tccctccactcggaaggac Sangon Biotech N A Primer C Myc Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sangon+biotech+n+a+primer/primer/pm42054210-662-185-186
    Average 86 stars, based on 1 article reviews
    tccctccactcggaaggac sangon biotech n a primer c myc reverse - by Bioz Stars, 2026-11
    86/100 stars

    Images

    Related Articles

    Generated:

    Article Title: EBV infection and HLA-DR15 jointly drive multiple sclerosis by myelin peptide presentation.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Cell Lines BLS-DR2a cells Generated by B. Kwok, Benaroya Research Institute, Seattle N/A BLS-DR2b cells Generated by B. Kwok, Benaroya Research Institute, Seattle N/A TCC3A6 Vergelli et al. 67 N/A TCC5F6 Vergelli et al. 65,68 N/A Oligonucleotides Primer: Goli-MBP forward: 5 ′ -ATGGGAAAC CACGCAGGCAAACGAGAAT-3 ′ Sangon Biotech N/A Primer: MBP forward: 5 ′ -ATGGCGTCACAG AAGAGACCCTCC-3 ′ Sangon Biotech N/A Primer: Shared reverse primer for both Goli-MBP and MBP: 5 ′ -CCAGAGCCC CGCTTGGGC-3 ′ Sangon Biotech N/A Software and Algorithms FlowJo Tree Star https://www.flowjo.com/; RRID: SCR_008520 GraphPad Prism 8.0 Graphpad https://www.graphpad.com/; RRID: SCR_002798 NetMHCII 2.3 Server Jensen et al. 77 http://www.cbs.dtu.dk/services/ NetMHCII-2.3/ Venny2.1 Oliveros, J.C. (2007-2015) Venny. .. An interactive tool for comparing lists with Venn’s diagrams. https://bioinfogp.cnb.csic.es/tools/venny/ index.html; RRID:SCR_016561 IMGT/V-QUEST Brochet et al. 78 http://www.imgt.org/IMGT_vquest/vquest; RRID:SCR_010749 iceLogo Colaert et al. 79 https://iomics.ugent.be/icelogoserver/; RRID:SCR_012137 Wei Sheng Xin Newcore Biotech https://www.bioinformatics.com.cn/ CytoNavigator NovelBio https://sc.novelbrain.com/login TissueEnrich Jain and Tuteja 80 https://tissueenrich.gdcb.iastate.edu/ Human Protein Atlas Uhlen et al. 81 http://www.proteinatlas. org/;RRID:SCR_006710 Heatmaply Galili et al. 82 https://heatmaply.com/ Biorender BioRender http://biorender.com; RRID:SCR_018361 ll OPEN ACCESS e4 Cell 189, 1–16.e1–e8, January 22, 2026 Please cite this article in press as: Wang et al., EBV infection and HLA-DR15 jointly drive multiple sclerosis by myelin peptide presentation, Cell (2026), https://doi.org/10.1016/j.cell.2025.12.046 Article

    Software:

    Article Title: EBV infection and HLA-DR15 jointly drive multiple sclerosis by myelin peptide presentation.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Cell Lines BLS-DR2a cells Generated by B. Kwok, Benaroya Research Institute, Seattle N/A BLS-DR2b cells Generated by B. Kwok, Benaroya Research Institute, Seattle N/A TCC3A6 Vergelli et al. 67 N/A TCC5F6 Vergelli et al. 65,68 N/A Oligonucleotides Primer: Goli-MBP forward: 5 ′ -ATGGGAAAC CACGCAGGCAAACGAGAAT-3 ′ Sangon Biotech N/A Primer: MBP forward: 5 ′ -ATGGCGTCACAG AAGAGACCCTCC-3 ′ Sangon Biotech N/A Primer: Shared reverse primer for both Goli-MBP and MBP: 5 ′ -CCAGAGCCC CGCTTGGGC-3 ′ Sangon Biotech N/A Software and Algorithms FlowJo Tree Star https://www.flowjo.com/; RRID: SCR_008520 GraphPad Prism 8.0 Graphpad https://www.graphpad.com/; RRID: SCR_002798 NetMHCII 2.3 Server Jensen et al. 77 http://www.cbs.dtu.dk/services/ NetMHCII-2.3/ Venny2.1 Oliveros, J.C. (2007-2015) Venny. .. An interactive tool for comparing lists with Venn’s diagrams. https://bioinfogp.cnb.csic.es/tools/venny/ index.html; RRID:SCR_016561 IMGT/V-QUEST Brochet et al. 78 http://www.imgt.org/IMGT_vquest/vquest; RRID:SCR_010749 iceLogo Colaert et al. 79 https://iomics.ugent.be/icelogoserver/; RRID:SCR_012137 Wei Sheng Xin Newcore Biotech https://www.bioinformatics.com.cn/ CytoNavigator NovelBio https://sc.novelbrain.com/login TissueEnrich Jain and Tuteja 80 https://tissueenrich.gdcb.iastate.edu/ Human Protein Atlas Uhlen et al. 81 http://www.proteinatlas. org/;RRID:SCR_006710 Heatmaply Galili et al. 82 https://heatmaply.com/ Biorender BioRender http://biorender.com; RRID:SCR_018361 ll OPEN ACCESS e4 Cell 189, 1–16.e1–e8, January 22, 2026 Please cite this article in press as: Wang et al., EBV infection and HLA-DR15 jointly drive multiple sclerosis by myelin peptide presentation, Cell (2026), https://doi.org/10.1016/j.cell.2025.12.046 Article



    Similar Products

    tccctccactcggaaggac sangon biotech n a primer c myc reverse  (Sangon Biotech)
    86
    Sangon Biotech tccctccactcggaaggac sangon biotech n a primer c myc reverse
    Tccctccactcggaaggac Sangon Biotech N A Primer C Myc Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sangon+biotech+n+a+primer/primer/pm42054210-662-185-186
    Average 86 stars, based on 1 article reviews
    tccctccactcggaaggac sangon biotech n a primer c myc reverse - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    caagtctcagcaaaaggaacgt sangon biotech n a primer pdk4 promoter reverse  (Sangon Biotech)
    86
    Sangon Biotech caagtctcagcaaaaggaacgt sangon biotech n a primer pdk4 promoter reverse
    Caagtctcagcaaaaggaacgt Sangon Biotech N A Primer Pdk4 Promoter Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sangon+biotech+n+a+primer/a+biotech+gtcaatgtcggactcagaagtcaatcaagaagc+n+primer+reverse+sangon+sumo+tctgtactttca/pm42054210-662-58-59
    Average 86 stars, based on 1 article reviews
    caagtctcagcaaaaggaacgt sangon biotech n a primer pdk4 promoter reverse - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    ttcaacctgtcacctcatctttg sangon biotech n a primer fdx1 reverse  (Sangon Biotech)
    86
    Sangon Biotech ttcaacctgtcacctcatctttg sangon biotech n a primer fdx1 reverse
    Ttcaacctgtcacctcatctttg Sangon Biotech N A Primer Fdx1 Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sangon+biotech+n+a+primer/a+biotech+gtcaatgtcggactcagaagtcaatcaagaagc+n+primer+reverse+sangon+sumo+tctgtactttca/pm42054210-663-8-9
    Average 86 stars, based on 1 article reviews
    ttcaacctgtcacctcatctttg sangon biotech n a primer fdx1 reverse - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    cagcccagtcagaccgttaag sangon biotech n a primer lias reverse  (Sangon Biotech)
    86
    Sangon Biotech cagcccagtcagaccgttaag sangon biotech n a primer lias reverse
    Cagcccagtcagaccgttaag Sangon Biotech N A Primer Lias Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sangon+biotech+n+a+primer/a+biotech+gtcaatgtcggactcagaagtcaatcaagaagc+n+primer+reverse+sangon+sumo+tctgtactttca/pm42054210-663-22-23
    Average 86 stars, based on 1 article reviews
    cagcccagtcagaccgttaag sangon biotech n a primer lias reverse - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    gctgcctacagaagcgtacat sangon biotech n a primer psmd7 reverse  (Sangon Biotech)
    86
    Sangon Biotech gctgcctacagaagcgtacat sangon biotech n a primer psmd7 reverse
    Gctgcctacagaagcgtacat Sangon Biotech N A Primer Psmd7 Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sangon+biotech+n+a+primer/a+biotech+forward+ggacagagagaaaggaataaacaacc+n+primer+sangon+usp15/pm42054210-662-87-88
    Average 86 stars, based on 1 article reviews
    gctgcctacagaagcgtacat sangon biotech n a primer psmd7 reverse - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    ctccttaatgtcacgcacgat sangon biotech n a primer dlat forward  (Sangon Biotech)
    86
    Sangon Biotech ctccttaatgtcacgcacgat sangon biotech n a primer dlat forward
    Ctccttaatgtcacgcacgat Sangon Biotech N A Primer Dlat Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sangon+biotech+n+a+primer/primers/pm42054210-662-108-109
    Average 86 stars, based on 1 article reviews
    ctccttaatgtcacgcacgat sangon biotech n a primer dlat forward - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    ggttcatcagcatccgagtaga sangon biotech n a primer c myc forward  (Sangon Biotech)
    86
    Sangon Biotech ggttcatcagcatccgagtaga sangon biotech n a primer c myc forward
    Ggttcatcagcatccgagtaga Sangon Biotech N A Primer C Myc Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sangon+biotech+n+a+primer/a+biotech+forward+ggacagagagaaaggaataaacaacc+n+primer+sangon+usp15/pm42054210-662-178-179
    Average 86 stars, based on 1 article reviews
    ggttcatcagcatccgagtaga sangon biotech n a primer c myc forward - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    tcccatctggtatttgtcccaa sangon biotech n a primer psmd7 forward  (Sangon Biotech)
    86
    Sangon Biotech tcccatctggtatttgtcccaa sangon biotech n a primer psmd7 forward
    Tcccatctggtatttgtcccaa Sangon Biotech N A Primer Psmd7 Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sangon+biotech+n+a+primer/a+biotech+forward+ggacagagagaaaggaataaacaacc+n+primer+sangon+usp15/pm42054210-662-80-81
    Average 86 stars, based on 1 article reviews
    tcccatctggtatttgtcccaa sangon biotech n a primer psmd7 forward - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    catgtacgttgctatccaggc sangon biotech n a primer actin reverse  (Sangon Biotech)
    86
    Sangon Biotech catgtacgttgctatccaggc sangon biotech n a primer actin reverse
    Catgtacgttgctatccaggc Sangon Biotech N A Primer Actin Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sangon+biotech+n+a+primer/primer/pm42054210-662-101-102
    Average 86 stars, based on 1 article reviews
    catgtacgttgctatccaggc sangon biotech n a primer actin reverse - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    ggattgcccatatcacgtcttt sangon biotech n a primer pdk1 reverse  (Sangon Biotech)
    86
    Sangon Biotech ggattgcccatatcacgtcttt sangon biotech n a primer pdk1 reverse
    Ggattgcccatatcacgtcttt Sangon Biotech N A Primer Pdk1 Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sangon+biotech+n+a+primer/a+biotech+gtcaatgtcggactcagaagtcaatcaagaagc+n+primer+reverse+sangon+sumo+tctgtactttca/pm42054210-662-129-130
    Average 86 stars, based on 1 article reviews
    ggattgcccatatcacgtcttt sangon biotech n a primer pdk1 reverse - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier

    Image Search Results